About   Help   FAQ
D11Mit227 Primer Detail
Primers
  • Name
    D11Mit227
  • Primer 1 Sequence
    CCAGCATTTGAACCCTGATT
  • Primer 2 Sequence
    AAACCCATAGCCTGCATCTG
  • ID
    MGI:705006
  • Product Size
    167
  • Other IDs
    D11Mit227 (BROAD)
  • Note
    MIT assay: MT3870
    Additional information: MIT STS Marker Data Files
Genes
D11Mit227 DNA segment, Chr 11, Massachusetts Institute of Technology 227
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D11Mit227 c 166bp C3HeB/FeJLe
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit227 a 116bp CAST/EiJ
b 120bp SPRET/EiJ
c 166bp AKR/J, C3H/HeJ, DBA/2J
d 170bp B6.Cg-Lepob/+, C57BL/6J, NOD/MrkTac, NON/ShiLt
e 178bp LP/J
f 182bp A/J
g 188bp BALB/cJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D11Mit227 c 124bp CBA/CaOlaHsd
s 119bp SWR/OlaHsd
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/09/2025
MGI 6.24
The Jackson Laboratory