D17Mit16 Primer Detail MGI Mouse MGI:704998

D17Mit16 Primer Detail

Name

D17Mit16
Primer 1 Sequence

CCAGAAGACAGCATTCCACA
Primer 2 Sequence

GTATGTCAGGGCTAGTTGACAGG
ID

MGI:704998
Product Size

123
Other IDs

D17Mit16 (BROAD)
Note

MIT assay: A25
Additional information: MIT STS Marker Data Files

D17Mit16

DNA segment, Chr 17, Massachusetts Institute of Technology 16

J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4

Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit16	b	118bp	C57BL/6J
		c	106bp	BALB/cJ
		s	119bp	129X1/SvJ

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit16	a	88bp	NOD/MrkTac
	b	90bp	CAST/EiJ
	c	92bp	A/J, AKR/J, C3H/HeJ
	d	95bp	SPRET/EiJ
	e	106bp	BALB/cJ, DBA/2J
	f	107bp	NON/ShiLt
	g	118bp	C57BL/6J, LP/J
	h	119bp	B6.Cg-Lep^ob/+

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D17Mit16	c	larger	C58/J
	f	not given	FVB/NJ
	i	not given	I/LnJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit16	l	smaller	LG/J
	D17Mit16	s	larger	SM/J

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit16	c	142bp	CBA/CaOlaHsd
	D17Mit16	s	145bp	SWR/OlaHsd

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D17Mit16	a	118bp	129/SvW, C57BL/6W, C57BL/10W
	b	106bp	BALB/cW, DBA/2W
	c	92bp	A.CA/W, AKR/W, C3H/W, CBA/W
	d	88bp	BN/aW

J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24