About   Help   FAQ
D17Mit16 Primer Detail
Primers
  • Name
    D17Mit16
  • Primer 1 Sequence
    CCAGAAGACAGCATTCCACA
  • Primer 2 Sequence
    GTATGTCAGGGCTAGTTGACAGG
  • ID
    MGI:704998
  • Product Size
    123
  • Other IDs
    D17Mit16 (BROAD)
  • Note
    MIT assay: A25
    Additional information: MIT STS Marker Data Files
Genes
D17Mit16 DNA segment, Chr 17, Massachusetts Institute of Technology 16
Polymorphisms
J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4
Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit16 b 118bp C57BL/6J
c 106bp BALB/cJ
s 119bp 129X1/SvJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit16 a 88bp NOD/MrkTac
b 90bp CAST/EiJ
c 92bp A/J, AKR/J, C3H/HeJ
d 95bp SPRET/EiJ
e 106bp BALB/cJ, DBA/2J
f 107bp NON/ShiLt
g 118bp C57BL/6J, LP/J
h 119bp B6.Cg-Lepob/+
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D17Mit16 c larger C58/J
f not given FVB/NJ
i not given I/LnJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D17Mit16 l smaller LG/J
s larger SM/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D17Mit16 c 142bp CBA/CaOlaHsd
s 145bp SWR/OlaHsd
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D17Mit16 a 118bp 129/SvW, C57BL/6W, C57BL/10W
b 106bp BALB/cW, DBA/2W
c 92bp A.CA/W, AKR/W, C3H/W, CBA/W
d 88bp BN/aW
References
J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/07/2024
MGI 6.23
The Jackson Laboratory