About   Help   FAQ
D17Mit11 Primer Detail
Primers
  • Name
    D17Mit11
  • Primer 1 Sequence
    TGAATTTATGAGGGGGGTCA
  • Primer 2 Sequence
    TGTCCCATATCTCTCTTTATACACA
  • ID
    MGI:704994
  • Product Size
    171
  • Note
    MIT assay: M145
Genes
D17Mit11 DNA segment, Chr 17, Massachusetts Institute of Technology 11
Polymorphisms
J:39182 Xiao H, et al., Immunogenetics. 1997;45(4):274-7
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit11 a small B10.CAS3
b medium B10.CAS4, C3.SW-H2b
c large C3H/HeJ, C57BL/6, C57BL/10
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit11 a largest C57BL/6, MSM/Ms
b smaller DBA/2, JF1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit11 a 150bp BALB/cJ, DBA/2J, NON/ShiLt
b 160bp A/J, LP/J
c 176bp AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J
d 178bp NOD/MrkTac, SPRET/EiJ
e 192bp CAST/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D17Mit11 l smaller LG/J
s larger SM/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D17Mit11 c 143bp CBA/CaOlaHsd
s 126bp SWR/OlaHsd
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D17Mit11 a 176bp AKR/W, C3H/W, C57BL/6W, C57BL/10W, CBA/W
b 160bp 129/SvW, BN/aW
c 150bp A.CA/W, BALB/cW, DBA/2W
References
J:39182 Xiao H, et al., Fine mapping of 12 microsatellites and two new recombinants in the distal H2 complex on mouse chromosome 17. Immunogenetics. 1997;45(4):274-7
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory