About   Help   FAQ
D10Mit14 Primer Detail
Primers
  • Name
    D10Mit14
  • Primer 1 Sequence
    AGAGGGGACAAGGAGAGACC
  • Primer 2 Sequence
    AAGGTTTGGGTTCAGTTCCC
  • ID
    MGI:704992
  • Product Size
    190
  • Other IDs
    D10Mit14 (BROAD)
  • Note
    MIT assay: M175
    Additional information: MIT STS Marker Data Files
Genes
D10Mit14 DNA segment, Chr 10, Massachusetts Institute of Technology 14
Polymorphisms
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D10Mit14 a largest JF1, MSM/Ms
b smaller C57BL/6
c smallest DBA/2
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit14 a 174bp CAST/EiJ
b 182bp A/J, BALB/cJ, DBA/2J, LP/J, NOD/MrkTac
c 188bp AKR/J
d 192bp B6.Cg-Lepob/+, C57BL/6J, NON/ShiLt
e 194bp C3H/HeJ
f 199bp SPRET/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D10Mit14 l smaller LG/J
s larger SM/J
References
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory