D10Mit14 Primer Detail MGI Mouse MGI:704992

D10Mit14 Primer Detail

Name

D10Mit14
Primer 1 Sequence

AGAGGGGACAAGGAGAGACC
Primer 2 Sequence

AAGGTTTGGGTTCAGTTCCC
ID

MGI:704992
Product Size

190
Other IDs

D10Mit14 (BROAD)
Note

MIT assay: M175
Additional information: MIT STS Marker Data Files

D10Mit14

DNA segment, Chr 10, Massachusetts Institute of Technology 14

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D10Mit14	a	largest	JF1, MSM/Ms
		b	smaller	C57BL/6
		c	smallest	DBA/2

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit14	a	174bp	CAST/EiJ
	b	182bp	A/J, BALB/cJ, DBA/2J, LP/J, NOD/MrkTac
	c	188bp	AKR/J
	d	192bp	B6.Cg-Lep^ob/+, C57BL/6J, NON/ShiLt
	e	194bp	C3H/HeJ
	f	199bp	SPRET/EiJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit14	l	smaller	LG/J
	D10Mit14	s	larger	SM/J

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24