D17Mit18 Primer Detail MGI Mouse MGI:704990

D17Mit18 Primer Detail

Name

D17Mit18
Primer 1 Sequence

GCAGCTCATTCTTAGTCCCTAAT
Primer 2 Sequence

TCATGAGTCCCCAAACTAGC
ID

MGI:704990
Product Size

250
Note

MIT assay: M33

D17Mit18

DNA segment, Chr 17, Massachusetts Institute of Technology 18

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit18	a	241bp	129X1/Sv
Not Specified	D17Mit18	f	237, 241, 246bp	CD-1

J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4

Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit18	b	246bp	C57BL/6J
		c	241bp	BALB/cJ
		s	251bp	129X1/SvJ

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit18	m	256bp	MOLF/EiJ
Not Specified	D17Mit18	s	absent	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit18	a	238bp	SPRET/EiJ
	b	241bp	BALB/cJ, C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt
	c	242bp	A/J
	d	246bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, LP/J
	e	256bp	CAST/EiJ

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/28/2024 MGI 6.13