D12Mit149 Primer Detail MGI Mouse MGI:704973

D12Mit149 Primer Detail

Name

D12Mit149
Primer 1 Sequence

CATGGCACACATACATACATGTG
Primer 2 Sequence

AACATAGCAATGGTATATAGGTATGGG
ID

MGI:704973
Product Size

132
Other IDs

D12Mit149 (BROAD)
Note

MIT assay: MT1597
Additional information: MIT STS Marker Data Files

DNA segment, Chr 12, Massachusetts Institute of Technology 149

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D12Mit149	b	larger than f	C57BL/6J
	c	137bp	C3HeB/FeJLe
	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit149	a	107bp	CAST/EiJ
	b	121bp	NOD/MrkTac
	c	127bp	NON/ShiLt
	d	133bp	B6.Cg-Lep^ob/+, C57BL/6J
	e	137bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J
	f	141bp	SPRET/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24