About   Help   FAQ
D12Mit141 Primer Detail
Primers
  • Name
    D12Mit141
  • Primer 1 Sequence
    TAGGCAAATTCATTCTCTTACTTTAGG
  • Primer 2 Sequence
    GTGAGTCCATTGTCTGTAAGATGG
  • ID
    MGI:704971
  • Product Size
    136
  • Other IDs
    D12Mit141 (BROAD)
  • Note
    MIT assay: MT828
    Additional information: MIT STS Marker Data Files
Genes
D12Mit141 DNA segment, Chr 12, Massachusetts Institute of Technology 141
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit141 a 98bp CAST/EiJ
b 114bp SPRET/EiJ
c 131bp C3H/HeJ
d 133bp A/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, LP/J
e 143bp DBA/2J
f 146bp NON/ShiLt
g 148bp AKR/J, NOD/MrkTac
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D12Mit41 c 137bp CBA/CaOlaHsd
s 135bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory