About   Help   FAQ
D1Mit10 Primer Detail
Primers
  • Name
    D1Mit10
  • Primer 1 Sequence
    AAACCATGCAGGTACTGATATGG
  • Primer 2 Sequence
    GAAGAAATTAACTGAGAGCAAGGC
  • ID
    MGI:704962
  • Product Size
    139
  • Other IDs
    D1Mit10 (BROAD)
  • Note
    MIT assay: A117
    Additional information: MIT STS Marker Data Files
Genes
D1Mit10 DNA segment, Chr 1, Massachusetts Institute of Technology 10
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
Not Specified D1Mit10 c 144bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit10 a 122bp SPRET/EiJ
b 133bp AKR/J, LP/J
c 139bp A/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt
d 144bp C3H/HeJ
e 150bp CAST/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D1Mit10 l smaller LG/J
s larger SM/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D1Mit10 c 171bp CBA/CaOlaHsd
s 188bp SWR/OlaHsd
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory