D7Mit21 Primer Detail MGI Mouse MGI:704960

D7Mit21 Primer Detail

Name

D7Mit21
Primer 1 Sequence

GGGTTGAACCTTACAGGGGT
Primer 2 Sequence

ATCAAACCAGCCCAAGTGAC
ID

MGI:704960
Product Size

126
Other IDs

D7Mit21 (BROAD)
Note

MIT assay: A771
Additional information: MIT STS Marker Data Files

D7Mit21

DNA segment, Chr 7, Massachusetts Institute of Technology 21

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D7Mit21	c	132bp	C3HeB/FeJLe
	D7Mit21	f	smaller	FVB/N

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D7Mit21	m	109bp	MOLF/EiJ
Not Specified	D7Mit21	s	135bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D7Mit21	a	128bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
	b	132bp	C3H/HeJ, CAST/EiJ, DBA/2J, LP/J
	c	166bp	SPRET/EiJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D7Mit21	l	larger	LG/J
	D7Mit21	s	smaller	SM/J

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24