About   Help   FAQ
D15Mit111 Primer Detail
Primers
  • Name
    D15Mit111
  • Primer 1 Sequence
    GTTTCAGAAGGCAATGTCTGG
  • Primer 2 Sequence
    GCTCAGTGCTAATCTCTGACTCC
  • ID
    MGI:704942
  • Product Size
    170
  • Other IDs
    D15Mit111 (BROAD)
  • Note
    MIT assay: MT1059
    Additional information: MIT STS Marker Data Files
Genes
D15Mit111 DNA segment, Chr 15, Massachusetts Institute of Technology 111
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D15Mit111 c 189bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit111 a 167bp AKR/J, BALB/cJ, C57BL/6J, NOD/MrkTac, NON/ShiLt, SPRET/EiJ
b 181bp A/J
c 189bp C3H/HeJ, DBA/2J
d 190bp CAST/EiJ
e 213bp LP/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D15Mit111 a 197bp DBA/2W
b 189bp 129/SvW, A.CA/W, C3H/W, CBA/W
c 167bp AKR/W, BALB/cW, BN/aW, C57BL/6W, C57BL/10W
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory