About   Help   FAQ
D8Mit242 Primer Detail
Primers
  • Name
    D8Mit242
  • Primer 1 Sequence
    TGTGCAACCAATTTCTTCCA
  • Primer 2 Sequence
    CCCATGATTTATTCAGACTGAGG
  • ID
    MGI:704921
  • Product Size
    166
  • Other IDs
    D8Mit242 (BROAD)
  • Note
    MIT assay: MT3737
    Additional information: MIT STS Marker Data Files
Genes
D8Mit242 DNA segment, Chr 8, Massachusetts Institute of Technology 242
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D8Mit242 a 188bp 129X1/Sv
f 196bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit242 a 166bp B6.Cg-Lepob/+, C57BL/6J
b 188bp BALB/cJ, LP/J
c 190bp A/J, AKR/J
d 194bp CAST/EiJ
e 196bp C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt
f 214bp SPRET/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D8Mit242 a 185bp A/JOlaHsd, AKR/OlaHsd
b 165bp C57BL/6JOlaHsd
c 183bp 129P3/J, BALB/cJ
d 191bp C3H/HeJ, C57BL/10, DBA/2J, SJL/J
j 195bp JF1
p 177bp PWB
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D8Mit242 a smaller 129P3/J
s larger SJL/J
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory