D8Mit242 Primer Detail MGI Mouse MGI:704921

D8Mit242 Primer Detail

Name

D8Mit242
Primer 1 Sequence

TGTGCAACCAATTTCTTCCA
Primer 2 Sequence

CCCATGATTTATTCAGACTGAGG
ID

MGI:704921
Product Size

166
Other IDs

D8Mit242 (BROAD)
Note

MIT assay: MT3737
Additional information: MIT STS Marker Data Files

D8Mit242

DNA segment, Chr 8, Massachusetts Institute of Technology 242

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D8Mit242	a	188bp	129X1/Sv
Not Specified	D8Mit242	f	196bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D8Mit242	a	166bp	B6.Cg-Lep^ob/+, C57BL/6J
	b	188bp	BALB/cJ, LP/J
	c	190bp	A/J, AKR/J
	d	194bp	CAST/EiJ
	e	196bp	C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt
	f	214bp	SPRET/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D8Mit242	a	185bp	A/JOlaHsd, AKR/OlaHsd
	b	165bp	C57BL/6JOlaHsd
	c	183bp	129P3/J, BALB/cJ
	d	191bp	C3H/HeJ, C57BL/10, DBA/2J, SJL/J
	j	195bp	JF1
	p	177bp	PWB

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D8Mit242	a	smaller	129P3/J
	D8Mit242	s	larger	SJL/J

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24