About   Help   FAQ
D8Mit241 Primer Detail
Primers
  • Name
    D8Mit241
  • Primer 1 Sequence
    TCCTGTCTCCACAGACATGTG
  • Primer 2 Sequence
    GTTAGACATGTGGTCAAGCCTG
  • ID
    MGI:704920
  • Product Size
    116
  • Other IDs
    D8Mit241 (BROAD)
  • Note
    MIT assay: MTAR4046
    Additional information: MIT STS Marker Data Files
Genes
D8Mit241 DNA segment, Chr 8, Massachusetts Institute of Technology 241
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit241 a 110bp A/J, AKR/J
b 112bp BALB/cJ, NOD/MrkTac, NON/ShiLt
c 116bp B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J, LP/J
d 122bp SPRET/EiJ
e 126bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D8Mit241 c 109bp CBA/CaOlaHsd
s 111bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/28/2024
MGI 6.13
The Jackson Laboratory