About   Help   FAQ
D8Mit249 Primer Detail
Primers
  • Name
    D8Mit249
  • Primer 1 Sequence
    AAACTCACACACACAGAGACAACA
  • Primer 2 Sequence
    GCCCCAGTGTGACTAAGGAG
  • ID
    MGI:704917
  • Product Size
    150
  • Other IDs
    D8Mit249 (BROAD)
  • Note
    MIT assay: MT3583
    Additional information: MIT STS Marker Data Files
Genes
D8Mit249 DNA segment, Chr 8, Massachusetts Institute of Technology 249
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit249 a 148bp B6.Cg-Lepob/+, C57BL/6J
b 162bp CAST/EiJ
c 172bp A/J, C3H/HeJ, DBA/2J, NON/ShiLt
d 176bp AKR/J, BALB/cJ, LP/J, NOD/MrkTac
e 252bp SPRET/EiJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D8Mit249 c largest C58/J
f not given FVB/NJ
i larger I/LnJ
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory