D8Mit15 Primer Detail MGI Mouse MGI:704915

D8Mit15 Primer Detail

Name

D8Mit15
Primer 1 Sequence

AGCTGAATTTGAGCTAGTCG
Primer 2 Sequence

AAGCTTACGGTTTAATCCCC
ID

MGI:704915
Product Size

180
Other IDs

D8Mit15 (BROAD)
Note

MIT assay: D20
Additional information: MIT STS Marker Data Files

D8Mit15

DNA segment, Chr 8, Massachusetts Institute of Technology 15

J:38923 Becker-Follmann J, et al., Mamm Genome. 1997 Mar;8(3):172-7

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D8Mit15	d	0.160kb	DS8, M. spretus
Not Specified	D8Mit15	m	0.148kb	M. m. molossinus

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D8Mit15	m	190bp	MOLF/EiJ
Not Specified	D8Mit15	s	182bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D8Mit15	a	158bp	SPRET/EiJ
	b	175bp	AKR/J, LP/J
	c	177bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, NON/ShiLt
	d	182bp	NOD/MrkTac
	e	183bp	CAST/EiJ

J:38923 Becker-Follmann J, et al., High-resolution mapping of a linkage group on mouse chromosome 8 conserved on human chromosome 16Q. Mamm Genome. 1997 Mar;8(3):172-7

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 01/06/2026 MGI 6.24