About   Help   FAQ
D8Mit14 Primer Detail
Primers
  • Name
    D8Mit14
  • Primer 1 Sequence
    TTTTCACACTCACGTGTGCG
  • Primer 2 Sequence
    GTCTCTCCTTCCTGGCGCTG
  • ID
    MGI:704914
  • Product Size
    143
  • Note
    MIT assay: L34
Genes
D8Mit14 DNA segment, Chr 8, Massachusetts Institute of Technology 14
Polymorphisms
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D8Mit14 a largest JF1, MSM/Ms
b smaller C57BL/6, DBA/2
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit14 a 130bp SPRET/EiJ
b 138bp AKR/J, C3H/HeJ, NOD/MrkTac
c 142bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J, NON/ShiLt
d 155bp CAST/EiJ
e 167bp A/J, BALB/cJ, LP/J
References
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/09/2026
MGI 6.24
The Jackson Laboratory