D8Mit14 Primer Detail MGI Mouse MGI:704914

D8Mit14 Primer Detail

Name

D8Mit14
Primer 1 Sequence

TTTTCACACTCACGTGTGCG
Primer 2 Sequence

GTCTCTCCTTCCTGGCGCTG
ID

MGI:704914
Product Size

143
Note

MIT assay: L34

D8Mit14

DNA segment, Chr 8, Massachusetts Institute of Technology 14

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D8Mit14	a	largest	JF1, MSM/Ms
Not Specified	D8Mit14	b	smaller	C57BL/6, DBA/2

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D8Mit14	a	130bp	SPRET/EiJ
	b	138bp	AKR/J, C3H/HeJ, NOD/MrkTac
	c	142bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, NON/ShiLt
	d	155bp	CAST/EiJ
	e	167bp	A/J, BALB/cJ, LP/J

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/21/2024 MGI 6.23