About   Help   FAQ
D8Mit13 Primer Detail
Primers
  • Name
    D8Mit13
  • Primer 1 Sequence
    CCTCTCTCCAGCCCTGTAAG
  • Primer 2 Sequence
    AACGTTTGTGCTAAGTGGCC
  • ID
    MGI:704910
  • Product Size
    98
  • Other IDs
    D8Mit13 (BROAD)
  • Note
    MIT assay: M77
    Additional information: MIT STS Marker Data Files
Genes
D8Mit13 DNA segment, Chr 8, Massachusetts Institute of Technology 13
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D8Mit13 m 114 MOLF/EiJ
s 124bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit13 a 91bp C3H/HeJ
b 94bp AKR/J
c 98bp A/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt
d 105bp BALB/cJ
e 108bp LP/J
f 114bp CAST/EiJ, SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D8Mit13 c 204bp CBA/CaOlaHsd
s 207bp SWR/OlaHsd
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D8Mit13 a 105bp BALB/cW
b 100bp 129/SvW, A.CA/W, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W
c 96bp AKR/W, BN/aW
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory