D8Mit13 Primer Detail MGI Mouse MGI:704910

D8Mit13 Primer Detail

Name

D8Mit13
Primer 1 Sequence

CCTCTCTCCAGCCCTGTAAG
Primer 2 Sequence

AACGTTTGTGCTAAGTGGCC
ID

MGI:704910
Product Size

98
Other IDs

D8Mit13 (BROAD)
Note

MIT assay: M77
Additional information: MIT STS Marker Data Files

D8Mit13

DNA segment, Chr 8, Massachusetts Institute of Technology 13

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D8Mit13	m	114	MOLF/EiJ
Not Specified	D8Mit13	s	124bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D8Mit13	a	91bp	C3H/HeJ
	b	94bp	AKR/J
	c	98bp	A/J, B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt
	d	105bp	BALB/cJ
	e	108bp	LP/J
	f	114bp	CAST/EiJ, SPRET/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D8Mit13	c	204bp	CBA/CaOlaHsd
	D8Mit13	s	207bp	SWR/OlaHsd

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D8Mit13	a	105bp	BALB/cW
	b	100bp	129/SvW, A.CA/W, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W
	c	96bp	AKR/W, BN/aW

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 03/18/2025 MGI 6.24