About   Help   FAQ
D7Mit253 Primer Detail
Primers
  • Name
    D7Mit253
  • Primer 1 Sequence
    TGTGGGTGCAACCAAATG
  • Primer 2 Sequence
    TTTGGTGATATAGATACTAGGTGTGTG
  • ID
    MGI:704901
  • Product Size
    89
  • Other IDs
    D7Mit253 (BROAD)
  • Note
    MIT assay: MT2801
    Additional information: MIT STS Marker Data Files
Genes
D7Mit253 DNA segment, Chr 7, Massachusetts Institute of Technology 253
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit253 a 84bp CAST/EiJ
b 86bp AKR/J, BALB/cJ, NOD/MrkTac, NON/ShiLt
c 90bp A/J, B6.Cg-Lepob/+, C57BL/6J
d 92bp DBA/2J
e 96bp SPRET/EiJ
f 100bp LP/J
g 104bp C3H/HeJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D7Mit253 c not given C58/J
f not given FVB/NJ
i larger I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D7Mit253 c 101bp CBA/CaOlaHsd
s 85bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory