About   Help   FAQ
D13Mit283 Primer Detail
Primers
  • Name
    D13Mit283
  • Primer 1 Sequence
    GGAAGCAGTCTCCTGCCTC
  • Primer 2 Sequence
    GAGAGGTGGCACATGAGGTT
  • ID
    MGI:704892
  • Product Size
    114
  • Other IDs
    D13Mit283 (BROAD)
  • Note
    MIT assay: MTH1411
    Additional information: MIT STS Marker Data Files
Genes
D13Mit283 DNA Segment, Chr 13, Massachusetts Institute of Technology 283
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D13Mit283 a 106bp CAST/EiJ
b 114bp AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J
c 126bp A/J, BALB/cJ, NON/ShiLt
d 128bp LP/J, SPRET/EiJ
e 136bp DBA/2J, NOD/MrkTac
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D13Mit283 c smaller CBA/Kw
e larger KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/07/2026
MGI 6.24
The Jackson Laboratory