D13Mit283 Primer Detail MGI Mouse MGI:704892

D13Mit283 Primer Detail

Name

D13Mit283
Primer 1 Sequence

GGAAGCAGTCTCCTGCCTC
Primer 2 Sequence

GAGAGGTGGCACATGAGGTT
ID

MGI:704892
Product Size

114
Other IDs

D13Mit283 (BROAD)
Note

MIT assay: MTH1411
Additional information: MIT STS Marker Data Files

DNA Segment, Chr 13, Massachusetts Institute of Technology 283

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit283	a	106bp	CAST/EiJ
	b	114bp	AKR/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J
	c	126bp	A/J, BALB/cJ, NON/ShiLt
	d	128bp	LP/J, SPRET/EiJ
	e	136bp	DBA/2J, NOD/MrkTac

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D13Mit283	c	smaller	CBA/Kw
	D13Mit283	e	larger	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23