About   Help   FAQ
D5Mit221 Primer Detail
Primers
  • Name
    D5Mit221
  • Primer 1 Sequence
    TAGGAGGTCTTGTTTTGTTTTCTG
  • Primer 2 Sequence
    CACACGGAGAAGGGAGAAAA
  • ID
    MGI:704873
  • Product Size
    148
  • Other IDs
    D5Mit221 (BROAD)
  • Note
    MIT assay: MT2452
    Additional information: MIT STS Marker Data Files
Genes
D5Mit221 DNA segment, Chr 5, Massachusetts Institute of Technology 221
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D5Mit221 a 133bp 129X1/Sv
f 123, 133bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit221 a 128bp CAST/EiJ
b 129bp B6.Cg-Lepob/+
c 151bp C57BL/6J
d 153bp A/J, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
e 155bp BALB/cJ
f 157bp SPRET/EiJ
g 159bp AKR/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D5Mit221 c 152bp CBA/CaOlaHsd
s 160bp SWR/OlaHsd
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory