About   Help   FAQ
D11Mit86 Primer Detail
Primers
  • Name
    D11Mit86
  • Primer 1 Sequence
    TTGACATTGTGACAAAGACTTTCA
  • Primer 2 Sequence
    AAGGCATCATGAGGTTTTTAGTG
  • ID
    MGI:704852
  • Product Size
    124
  • Other IDs
    D11Mit86 (BROAD)
  • Note
    MIT assay: MPC1098
    Additional information: MIT STS Marker Data Files
Genes
D11Mit86 DNA segment, Chr 11, Massachusetts Institute of Technology 86
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit86 a 124bp NON/ShiLt
b 126bp AKR/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J
c 128bp CAST/EiJ
d 132bp NOD/MrkTac
e 134bp C3H/HeJ, DBA/2J, LP/J
f 136bp A/J
g 138bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D11Mit86 c 124bp CBA/CaOlaHsd
s 119bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory