About   Help   FAQ
D2Mit11 Primer Detail
Primers
  • Name
    D2Mit11
  • Primer 1 Sequence
    CAAACCCCCAGCTCTCTCTT
  • Primer 2 Sequence
    CCATACCCAGGCTCCATCTA
  • ID
    MGI:704835
  • Product Size
    225
  • Other IDs
    D2Mit11 (BROAD)
  • Note
    MIT assay: M134
    Additional information: MIT STS Marker Data Files
Genes
D2Mit11 DNA segment, Chr 2, Massachusetts Institute of Technology 11
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit11 a 226bp B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J, NON/ShiLt
b 232bp A/J, AKR/J, BALB/cJ, CAST/EiJ, LP/J, NOD/MrkTac
c 264bp SPRET/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D2Mit11 l larger LG/J
s smaller SM/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D2Mit11 a 232bp A.CA/W, AKR/W, BALB/cW
b 226bp 129/SvW, BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory