About   Help   FAQ
D18Mit147 Primer Detail
Primers
  • Name
    D18Mit147
  • Primer 1 Sequence
    GTAAGTCACTAGGAGCCATGTTTC
  • Primer 2 Sequence
    AGAACATGGTAGAGCACTGCTG
  • ID
    MGI:704819
  • Product Size
    150
  • Other IDs
    D18Mit147 (BROAD)
  • Note
    MIT assay: MT2005
    Additional information: MIT STS Marker Data Files
Genes
D18Mit147 DNA segment, Chr 18, Massachusetts Institute of Technology 147
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D18Mit147 a 146bp C3H/HeJ
b 152bp A/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, NOD/MrkTac
c 154bp AKR/J, DBA/2J, LP/J
d 156bp NON/ShiLt
e 176bp CAST/EiJ
f 178bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D18Mit147 c 150bp CBA/CaOlaHsd
s 149bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/07/2024
MGI 6.23
The Jackson Laboratory