D1Mit206 Primer Detail MGI Mouse MGI:704799

D1Mit206 Primer Detail

Name

D1Mit206
Primer 1 Sequence

TGAGGCACCTTTGTATTCAGC
Primer 2 Sequence

CCAGATGTCTTTGAACATTCTCC
ID

MGI:704799
Product Size

126
Other IDs

D1Mit206 (BROAD)
Note

MIT assay: MT820
Additional information: MIT STS Marker Data Files

D1Mit206

DNA segment, Chr 1, Massachusetts Institute of Technology 206

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit206	a	114bp	AKR/J, CAST/EiJ, DBA/2J, NON/ShiLt
	b	116bp	A/J
	c	118bp	BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac
	d	123bp	C57BL/6J
	e	126bp	B6.Cg-Lep^ob/+

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D1Mit206	b	127bp	C57BL/6JOlaHsd
	c	119bp	129P3/J, BALB/cJ, SJL/J
	d	115bp	AKR/OlaHsd, DBA/2J
	h	109bp	C3H/HeJ
	j	123bp	JF1
	p	117bp	A/JOlaHsd, PWB
	r	121bp	C57BL/10

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24