About   Help   FAQ
D2Mit117 Primer Detail
Primers
  • Name
    D2Mit117
  • Primer 1 Sequence
    CCCAAAGAACATACATCAATGTG
  • Primer 2 Sequence
    TGGAGATGCATGTTTAAAACTCA
  • ID
    MGI:704790
  • Product Size
    175
  • Other IDs
    D2Mit117 (BROAD)
  • Note
    MIT assay: MPC1288
    Additional information: MIT STS Marker Data Files
Genes
D2Mit117 DNA segment, Chr 2, Massachusetts Institute of Technology 117
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit117 a 166bp SPRET/EiJ
b 170bp A/J
c 176bp AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac
d 178bp BALB/cJ, NON/ShiLt
e 230bp CAST/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D2Mit117 a 172bp 129P3/J, AKR/OlaHsd
b 166bp C57BL/6JOlaHsd
d 174bp A/JOlaHsd, BALB/cJ, C57BL/10, DBA/2J, JF1, PWB, SJL/J
h 170bp C3H/HeJ
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory