D2Mit117 Primer Detail MGI Mouse MGI:704790

D2Mit117 Primer Detail

Name

D2Mit117
Primer 1 Sequence

CCCAAAGAACATACATCAATGTG
Primer 2 Sequence

TGGAGATGCATGTTTAAAACTCA
ID

MGI:704790
Product Size

175
Other IDs

D2Mit117 (BROAD)
Note

MIT assay: MPC1288
Additional information: MIT STS Marker Data Files

D2Mit117

DNA segment, Chr 2, Massachusetts Institute of Technology 117

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D2Mit117	a	166bp	SPRET/EiJ
	b	170bp	A/J
	c	176bp	AKR/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac
	d	178bp	BALB/cJ, NON/ShiLt
	e	230bp	CAST/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D2Mit117	a	172bp	129P3/J, AKR/OlaHsd
	b	166bp	C57BL/6JOlaHsd
	d	174bp	A/JOlaHsd, BALB/cJ, C57BL/10, DBA/2J, JF1, PWB, SJL/J
	h	170bp	C3H/HeJ

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24