D2Mit380 Primer Detail MGI Mouse MGI:704779

D2Mit380 Primer Detail

Name

D2Mit380
Primer 1 Sequence

CCTCAGGTCTGAAATGAGGTG
Primer 2 Sequence

AATGATGTGCATGTGCGC
ID

MGI:704779
Product Size

118
Other IDs

D2Mit380 (BROAD)
Note

MIT assay: MTH319
Additional information: MIT STS Marker Data Files

D2Mit380

DNA segment, Chr 2, Massachusetts Institute of Technology 380

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D2Mit380	a	118bp	B6.Cg-Lep^ob/+, C57BL/6J
	b	120bp	BALB/cJ, C3H/HeJ, CAST/EiJ, DBA/2J, LP/J, NON/ShiLt
	c	132bp	A/J, AKR/J, NOD/MrkTac

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D2Mit380	a	133bp	A/JOlaHsd, AKR/OlaHsd
	b	119bp	129P3/J, C57BL/6JOlaHsd, C57BL/10
	d	121bp	BALB/cJ, C3H/HeJ, DBA/2J, SJL/J
	j	149bp	JF1
	p	159bp	PWB

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D2Mit380	l	smaller	LG/J
	D2Mit380	s	larger	SM/J

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/16/2024 MGI 6.23