About   Help   FAQ
D2Mit380 Primer Detail
Primers
  • Name
    D2Mit380
  • Primer 1 Sequence
    CCTCAGGTCTGAAATGAGGTG
  • Primer 2 Sequence
    AATGATGTGCATGTGCGC
  • ID
    MGI:704779
  • Product Size
    118
  • Other IDs
    D2Mit380 (BROAD)
  • Note
    MIT assay: MTH319
    Additional information: MIT STS Marker Data Files
Genes
D2Mit380 DNA segment, Chr 2, Massachusetts Institute of Technology 380
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit380 a 118bp B6.Cg-Lepob/+, C57BL/6J
b 120bp BALB/cJ, C3H/HeJ, CAST/EiJ, DBA/2J, LP/J, NON/ShiLt
c 132bp A/J, AKR/J, NOD/MrkTac
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D2Mit380 a 133bp A/JOlaHsd, AKR/OlaHsd
b 119bp 129P3/J, C57BL/6JOlaHsd, C57BL/10
d 121bp BALB/cJ, C3H/HeJ, DBA/2J, SJL/J
j 149bp JF1
p 159bp PWB
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D2Mit380 l smaller LG/J
s larger SM/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory