D19Mit63 Primer Detail MGI Mouse MGI:704768

D19Mit63 Primer Detail

Name

D19Mit63
Primer 1 Sequence

CGCTTTCTTTGACTGGAATG
Primer 2 Sequence

GTCCTTTCACTTTCCACATGTG
ID

MGI:704768
Product Size

150
Other IDs

D19Mit63 (BROAD)
Note

MIT assay: MMH328
Additional information: MIT STS Marker Data Files

D19Mit63

DNA segment, Chr 19, Massachusetts Institute of Technology 63

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D19Mit63	a	146bp	A/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	b	152bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J
	c	156bp	SPRET/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D19Mit63	a	147bp	AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10, SJL/J
	d	141bp	129P3/J, A/JOlaHsd, BALB/cJ, C3H/HeJ, DBA/2J
	p	151bp	JF1, PWB

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/23/2024 MGI 6.23