About   Help   FAQ
D17Mit234 Primer Detail
Primers
  • Name
    D17Mit234
  • Primer 1 Sequence
    GCAAAGACAAAAATTGAAATGTG
  • Primer 2 Sequence
    CTGCTTAGCACACATGCTTTG
  • ID
    MGI:704761
  • Product Size
    125
  • Other IDs
    D17Mit234 (BROAD)
  • Note
    MIT assay: MTH1072
    Additional information: MIT STS Marker Data Files
Genes
D17Mit234 DNA Segment, Chr 17, Massachusetts Institute of Technology 234
Polymorphisms
J:39182 Xiao H, et al., Immunogenetics. 1997;45(4):274-7
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit234 a small B10.CAS3
b medium C3.SW-H2b
c large C3H/HeJ, C57BL/6, C57BL/10
d larger B10.CAS4
J:44833 Meagher S, et al., Hereditas. 1997;127(1-2):75-82
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit234 a smallest M. spretus
b larger A.CA-H2f/Sn, P/J, RIIIS/J
c larger than above C57BL/6J, CBA/J, SJL/J, SM/J, SWR/J
d larger than above CAST/EiJ
e larger than above DBA/2J
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit234 a 100bp SPRET/EiJ
b 119bp LP/J
c 125bp A/J, AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
d 127bp CAST/EiJ
e 129bp BALB/cJ, DBA/2J
References
J:39182 Xiao H, et al., Fine mapping of 12 microsatellites and two new recombinants in the distal H2 complex on mouse chromosome 17. Immunogenetics. 1997;45(4):274-7
J:44833 Meagher S, et al., A microsatellite-based MHC genotyping system for house mice (Mus domesticus). Hereditas. 1997;127(1-2):75-82
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory