About   Help   FAQ
D17Mit233 Primer Detail
Primers
  • Name
    D17Mit233
  • Primer 1 Sequence
    GACTGGTCTACAGAATGAGTTCCA
  • Primer 2 Sequence
    CCTCAGAACCCTGAGACCTG
  • ID
    MGI:704760
  • Product Size
    116
  • Other IDs
    D17Mit233 (BROAD)
  • Note
    MIT assay: MTH1207
    Additional information: MIT STS Marker Data Files
Genes
D17Mit233 DNA Segment, Chr 17, Massachusetts Institute of Technology 233
Polymorphisms
J:44833 Meagher S, et al., Hereditas. 1997;127(1-2):75-82
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit233 a smallest M. spretus
b larger DBA/2J, SJL/J
c larger than above CBA/J, P/J, SM/J
d larger than above C57BL/6J, SWR/J
e larger than above A.CA-H2f/Sn, CAST/EiJ
f larger than above RIIIS/J
g larger than above M. caroli
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit233 a 110bp A/J, BALB/cJ, DBA/2J
b 112bp AKR/J, C3H/HeJ, LP/J
c 122bp B6.Cg-Lepob/+, C57BL/6J, NOD/MrkTac, NON/ShiLt
d 128bp CAST/EiJ
References
J:44833 Meagher S, et al., A microsatellite-based MHC genotyping system for house mice (Mus domesticus). Hereditas. 1997;127(1-2):75-82
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory