D19Mit69 Primer Detail MGI Mouse MGI:704755

D19Mit69 Primer Detail

Name

D19Mit69
Primer 1 Sequence

AAAAACTGAGGACACAAAATTGTG
Primer 2 Sequence

TCTCACAATAACTTCTCCAAAATCC
ID

MGI:704755
Product Size

136
Other IDs

D19Mit69 (BROAD)
Note

MIT assay: MT2088
Additional information: MIT STS Marker Data Files

D19Mit69

DNA segment, Chr 19, Massachusetts Institute of Technology 69

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D19Mit69	a	137bp	129X1/Sv
Not Specified	D19Mit69	f	141, 147bp	CD-1

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D19Mit69	m	145bp	MOLF/EiJ
Not Specified	D19Mit69	s	185bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D19Mit69	a	137bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
	b	147bp	C3H/HeJ, DBA/2J
	c	153bp	AKR/J
	d	181bp	CAST/EiJ

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D19Mit69	c	larger	CBA/Kw
	D19Mit69	e	smaller	KE

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24