D15Mit85 Primer Detail MGI Mouse MGI:704754

D15Mit85 Primer Detail

Name

D15Mit85
Primer 1 Sequence

AGATTCGGGGATTCCTGACT
Primer 2 Sequence

GCAAATGTGACATGAGTAAGGC
ID

MGI:704754
Product Size

196
Other IDs

D15Mit85 (BROAD)
Note

MIT assay: MPC2136
Additional information: MIT STS Marker Data Files

D15Mit85

DNA segment, Chr 15, Massachusetts Institute of Technology 85

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D15Mit85	a	179bp	A/J
	b	189bp	CAST/EiJ
	c	191bp	AKR/J
	d	193bp	B6.Cg-Lep^ob/+, BALB/cJ, NON/ShiLt
	e	195bp	C57BL/6J, LP/J, NOD/MrkTac
	f	197bp	C3H/HeJ, DBA/2J
	g	205bp	SPRET/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D15Mit85	a	193bp	AKR/OlaHsd
	c	197bp	BALB/cJ, C57BL/6JOlaHsd, C57BL/10, SJL/J
	d	201bp	C3H/HeJ, DBA/2J
	g	203bp	129P3/J
	j	205bp	JF1
	p	187bp	PWB
	w	179bp	A/JOlaHsd

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D15Mit85	c	119bp	CBA/CaOlaHsd
	D15Mit85	s	132bp	SWR/OlaHsd

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23