D18Mit33 Primer Detail MGI Mouse MGI:704718

D18Mit33 Primer Detail

Name

D18Mit33
Primer 1 Sequence

GCATGTCGTATCCATAAACATACG
Primer 2 Sequence

ATGCGGGCTTGACTTCTG
ID

MGI:704718
Product Size

140
Other IDs

D18Mit33 (BROAD)
Note

MIT assay: B316
Additional information: MIT STS Marker Data Files

D18Mit33

DNA segment, Chr 18, Massachusetts Institute of Technology 33

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D18Mit33	c	136bp	C3HeB/FeJLe
	D18Mit33	f	larger	FVB/N

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D18Mit33	m	140bp	MOLF/EiJ
Not Specified	D18Mit33	s	136bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D18Mit33	a	136bp	AKR/J, C3H/HeJ, DBA/2J, LP/J, NON/ShiLt
	b	138bp	CAST/EiJ
	c	140bp	A/J, BALB/cJ, NOD/MrkTac
	d	142bp	B6.Cg-Lep^ob/+, C57BL/6J
	e	154bp	SPRET/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/28/2024 MGI 6.13