D16Mit189 Primer Detail MGI Mouse MGI:704714

D16Mit189 Primer Detail

Name

D16Mit189
Primer 1 Sequence

ACAGTGTTTGTTTGTTTGTTTGTG
Primer 2 Sequence

CAGTACAGGAAGTCTTTGCATCC
ID

MGI:704714
Product Size

199
Other IDs

D16Mit189 (BROAD)
Note

MIT assay: MTH717
Additional information: MIT STS Marker Data Files

DNA segment, Chr 16, Massachusetts Institute of Technology 189

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D16Mit189	a	170bp	SPRET/EiJ
	b	180bp	CAST/EiJ
	c	185bp	A/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	d	199bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D16Mit189	a	248bp	AKR/OlaHsd, C57BL/10
	b	270bp	129P3/J, C57BL/6JOlaHsd
	d	242bp	A/JOlaHsd, BALB/cJ, C3H/HeJ, DBA/2J, SJL/J
	j	232bp	JF1
	p	260bp	PWB

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/21/2024 MGI 6.23