About   Help   FAQ
D16Mit189 Primer Detail
Primers
  • Name
    D16Mit189
  • Primer 1 Sequence
    ACAGTGTTTGTTTGTTTGTTTGTG
  • Primer 2 Sequence
    CAGTACAGGAAGTCTTTGCATCC
  • ID
    MGI:704714
  • Product Size
    199
  • Other IDs
    D16Mit189 (BROAD)
  • Note
    MIT assay: MTH717
    Additional information: MIT STS Marker Data Files
Genes
D16Mit189 DNA segment, Chr 16, Massachusetts Institute of Technology 189
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D16Mit189 a 170bp SPRET/EiJ
b 180bp CAST/EiJ
c 185bp A/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
d 199bp AKR/J, B6.Cg-Lepob/+, C57BL/6J
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D16Mit189 a 248bp AKR/OlaHsd, C57BL/10
b 270bp 129P3/J, C57BL/6JOlaHsd
d 242bp A/JOlaHsd, BALB/cJ, C3H/HeJ, DBA/2J, SJL/J
j 232bp JF1
p 260bp PWB
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory