About   Help   FAQ
D15Mit18 Primer Detail
Primers
  • Name
    D15Mit18
  • Primer 1 Sequence
    GGGCTAATTGATAAATGATTAGTGC
  • Primer 2 Sequence
    CCCAATTCAGGGTTTCTAACC
  • ID
    MGI:704680
  • Product Size
    132
  • Other IDs
    D15Mit18 (BROAD)
  • Note
    MIT assay: A1119
    Additional information: MIT STS Marker Data Files
Genes
D15Mit18 DNA segment, Chr 15, Massachusetts Institute of Technology 18
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D15Mit18 c 138bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit18 a 134bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
b 136bp CAST/EiJ
c 138bp C3H/HeJ, DBA/2J
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory