D15Mit10 Primer Detail MGI Mouse MGI:704674

D15Mit10 Primer Detail

Name

D15Mit10
Primer 1 Sequence

GATCTATAACCAGGGCAGGG
Primer 2 Sequence

TTAATTCACGGAAATGTTTCAATTT
ID

MGI:704674
Product Size

222
Other IDs

D15Mit10 (BROAD)
Note

MIT assay: M76
Additional information: MIT STS Marker Data Files

D15Mit10

DNA segment, Chr 15, Massachusetts Institute of Technology 10

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D15Mit10	m	222bp	MOLF/EiJ
Not Specified	D15Mit10	s	200bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D15Mit10	a	178bp	SPRET/EiJ
	b	220bp	A/J
	c	222bp	AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, DBA/2J, NON/ShiLt
	d	236bp	LP/J, NOD/MrkTac
	e	242bp	CAST/EiJ

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24