About   Help   FAQ
D15Mit13 Primer Detail
Primers
  • Name
    D15Mit13
  • Primer 1 Sequence
    GGAGACAAAAATGAACTCCTGG
  • Primer 2 Sequence
    TTGTAAGACAAGCATAGCTCAACA
  • ID
    MGI:704671
  • Product Size
    136
  • Other IDs
    D15Mit13 (BROAD)
  • Note
    MIT assay: A36
    Additional information: MIT STS Marker Data Files
Genes
D15Mit13 DNA segment, Chr 15, Massachusetts Institute of Technology 13
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D15Mit13 m 138bp MOLF/EiJ
s 162bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit13 a 108bp NOD/MrkTac
b 118bp DBA/2J, LP/J
c 122bp AKR/J
d 138bp A/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J
e 162bp CAST/EiJ
f 187bp SPRET/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D15Mit13 l larger LG/J
s smaller SM/J
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory