About   Help   FAQ
D15Mit14 Primer Detail
Primers
  • Name
    D15Mit14
  • Primer 1 Sequence
    GAGAGGAAAACCATGTCAATCACT
  • Primer 2 Sequence
    TCCTCTTAAACCAAGATCTCTGCT
  • ID
    MGI:704670
  • Product Size
    194
  • Other IDs
    D15Mit14 (BROAD)
  • Note
    MIT assay: D17
    Additional information: MIT STS Marker Data Files
Genes
D15Mit14 DNA segment, Chr 15, Massachusetts Institute of Technology 14
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D15Mit14 c 181bp C3HeB/FeJLe
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit14 a 181bp A/J, C3H/HeJ
b 186bp NON/ShiLt, SPRET/EiJ
c 188bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J, NOD/MrkTac
d 192bp BALB/cJ
e 227bp LP/J
f 270bp CAST/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D15Mit14 c 193bp BALB/cJ
d 189bp AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10, DBA/2J, SJL/J
g 219bp 129P3/J
j 223bp JF1
p 187bp PWB
w 183bp A/JOlaHsd, C3H/HeJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D15Mit14 l larger LG/J
s smaller SM/J
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory