About   Help   FAQ
D15Mit17 Primer Detail
Primers
  • Name
    D15Mit17
  • Primer 1 Sequence
    GCGTCACTGATAGTAGGGAG
  • Primer 2 Sequence
    GTACCCCAATCCTGAACCAC
  • ID
    MGI:704667
  • Product Size
    137
  • Other IDs
    D15Mit17 (BROAD)
  • Note
    MIT assay: D22
    Additional information: MIT STS Marker Data Files
Genes
D15Mit17 DNA segment, Chr 15, Massachusetts Institute of Technology 17
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D15Mit17 c 135bp C3HeB/FeJLe
f larger FVB/N
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D15Mit17 a largest C57BL/6, DBA/2
b smaller JF1, MSM/Ms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit17 a 135bp BALB/cJ, C3H/HeJ
b 138bp NOD/MrkTac
c 140bp CAST/EiJ, NON/ShiLt, SPRET/EiJ
d 142bp A/J, AKR/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J, LP/J
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory