About   Help   FAQ
D3Mit130 Primer Detail
Primers
  • Name
    D3Mit130
  • Primer 1 Sequence
    AACACATGAAACGTGTGCGT
  • Primer 2 Sequence
    TGATAGGCATGCTTAAGCCC
  • ID
    MGI:704664
  • Product Size
    125
  • Other IDs
    D3Mit130 (BROAD)
  • Note
    MIT assay: D1218
    Additional information: MIT STS Marker Data Files
Genes
D3Mit130 DNA segment, Chr 3, Massachusetts Institute of Technology 130
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit130 a 113bp AKR/J
b 121bp A/J, BALB/cJ, C3H/HeJ
c 131bp SPRET/EiJ
d 137bp LP/J, NON/ShiLt
e 149bp B6.Cg-Lepob/+, C57BL/6J, NOD/MrkTac
f 161bp DBA/2J
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D3Mit130 a 138bp AKR/OlaHsd, SJL/J
b 126bp C57BL/6JOlaHsd, C57BL/10
d 124bp A/JOlaHsd, BALB/cJ, C3H/HeJ, DBA/2J, JF1
g 130bp 129P3/J
p 136bp PWB
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D3Mit130 a larger 129P3/J
s smaller SJL/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D3Mit130 a 149bp 129/SvW, AKR/W, BN/aW, CBA/W
b 130bp A.CA/W, C3H/W, C57BL/6W, C57BL/10W, DBA/2W
c 121bp BALB/cW
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory