About   Help   FAQ
D7Mit31 Primer Detail
Primers
  • Name
    D7Mit31
  • Primer 1 Sequence
    TTCAAACCATCCAGTAAGTCCA
  • Primer 2 Sequence
    TTGGTGAACTGCTTCAATGC
  • ID
    MGI:704637
  • Product Size
    243
  • Other IDs
    D7Mit31 (BROAD)
  • Note
    MIT assay: D641
    Additional information: MIT STS Marker Data Files
Genes
D7Mit31 DNA segment, Chr 7, Massachusetts Institute of Technology 31
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit31 a 164bp SPRET/EiJ
b 194bp CAST/EiJ
c 224bp DBA/2J
d 226bp C3H/HeJ, LP/J
e 230bp A/J, BALB/cJ
f 238bp NOD/MrkTac
g 242bp AKR/J, NON/ShiLt
h 246bp B6.Cg-Lepob/+, C57BL/6J
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D7Mit31 b 244bp C57BL/6JOlaHsd
c 236bp BALB/cJ
d 222bp DBA/2J
g 220bp 129P3/J
h 226bp C3H/HeJ
j 186bp JF1
p 238bp AKR/OlaHsd, PWB
r 246bp C57BL/10
w 234bp A/JOlaHsd, SJL/J
J:57749 Hansen GM, et al., Genome Res. 2000 Feb;10(2):237-43
Endonuclease Gene Allele Fragments Strains
D7Mit31 l 0.225kb SB/LeJ
s 0.165kb M. spretus
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D7Mit31 c 222bp CBA/CaOlaHsd
s 233bp SWR/OlaHsd
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D7Mit31 a 246bp BN/aW, C57BL/6W, C57BL/10W
b 242bp A.CA/W, AKR/W, BALB/cW
c 226bp 129/SvW, C3H/W, CBA/W, DBA/2W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:57749 Hansen GM, et al., Genetic profile of insertion mutations in mouse leukemias and lymphomas. Genome Res. 2000 Feb;10(2):237-43
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory