D7Mit31 Primer Detail MGI Mouse MGI:704637

D7Mit31 Primer Detail

Name

D7Mit31
Primer 1 Sequence

TTCAAACCATCCAGTAAGTCCA
Primer 2 Sequence

TTGGTGAACTGCTTCAATGC
ID

MGI:704637
Product Size

243
Other IDs

D7Mit31 (BROAD)
Note

MIT assay: D641
Additional information: MIT STS Marker Data Files

D7Mit31

DNA segment, Chr 7, Massachusetts Institute of Technology 31

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D7Mit31	a	164bp	SPRET/EiJ
	b	194bp	CAST/EiJ
	c	224bp	DBA/2J
	d	226bp	C3H/HeJ, LP/J
	e	230bp	A/J, BALB/cJ
	f	238bp	NOD/MrkTac
	g	242bp	AKR/J, NON/ShiLt
	h	246bp	B6.Cg-Lep^ob/+, C57BL/6J

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D7Mit31	b	244bp	C57BL/6JOlaHsd
	c	236bp	BALB/cJ
	d	222bp	DBA/2J
	g	220bp	129P3/J
	h	226bp	C3H/HeJ
	j	186bp	JF1
	p	238bp	AKR/OlaHsd, PWB
	r	246bp	C57BL/10
	w	234bp	A/JOlaHsd, SJL/J

J:57749 Hansen GM, et al., Genome Res. 2000 Feb;10(2):237-43

Endonuclease	Gene	Allele	Fragments	Strains
	D7Mit31	l	0.225kb	SB/LeJ
	D7Mit31	s	0.165kb	M. spretus

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D7Mit31	c	222bp	CBA/CaOlaHsd
	D7Mit31	s	233bp	SWR/OlaHsd

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D7Mit31	a	246bp	BN/aW, C57BL/6W, C57BL/10W
	b	242bp	A.CA/W, AKR/W, BALB/cW
	c	226bp	129/SvW, C3H/W, CBA/W, DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:57749 Hansen GM, et al., Genetic profile of insertion mutations in mouse leukemias and lymphomas. Genome Res. 2000 Feb;10(2):237-43

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23