About   Help   FAQ
D1Mit480 Primer Detail
Primers
  • Name
    D1Mit480
  • Primer 1 Sequence
    TCATTGTGCCCTAAAACTTGG
  • Primer 2 Sequence
    GAGATGAAGCATTCTCAATTATGC
  • ID
    MGI:704635
  • Product Size
    168
  • Other IDs
    D1Mit480 (BROAD)
  • Note
    MIT assay: MJ5376
    Additional information: MIT STS Marker Data Files
Genes
D1Mit480 DNA Segment, Chr 1 Massachusetts Institute of Technology 480
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D1Mit480 a 158bp 129X1/Sv
f 154, 162bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit480 a 137bp CAST/EiJ
b 154bp AKR/J
c 158bp NOD/MrkTac
d 160bp DBA/2J, NON/ShiLt
e 162bp A/J, C3H/HeJ, LP/J
f 170bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J
g 186bp SPRET/EiJ
J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;
Endonuclease Gene Allele Fragments Strains
D1Mit480 c lower CBA/Kw
e upper KE
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory