About   Help   FAQ
DXMit192 Primer Detail
Primers
  • Name
    DXMit192
  • Primer 1 Sequence
    TACTTAAGATACCTATTGCACATGCA
  • Primer 2 Sequence
    GACCTCCAGTCACTTCAACTTG
  • ID
    MGI:704621
  • Product Size
    124
  • Other IDs
    DXMit192 (BROAD)
  • Note
    MIT assay: MTH1935
    Additional information: MIT STS Marker Data Files
Genes
DXMit192 DNA Segment, Chr X, Massachusetts Institute of Technology 192
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit192 a 122bp A/J, AKR/J, BALB/cJ, LP/J, NOD/MrkTac
b 124bp B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J
c 126bp DBA/2J, NON/ShiLt
d 130bp CAST/EiJ
e 132bp SPRET/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
DXMit192 b 118bp C3H/HeJ, C57BL/6JOlaHsd, C57BL/10
c 116bp 129P3/J, A/JOlaHsd, AKR/OlaHsd, BALB/cJ, SJL/J
d 120bp DBA/2J
j 128bp JF1
p 106bp PWB
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory