About   Help   FAQ
D9Mit179 Primer Detail
Primers
  • Name
    D9Mit179
  • Primer 1 Sequence
    TTTTTTCTGACCTCTGTTTAAGTGC
  • Primer 2 Sequence
    AGGACTACTCAAATTCAAACACAGC
  • ID
    MGI:704604
  • Product Size
    146
  • Other IDs
    D9Mit179 (BROAD)
  • Note
    MIT assay: MT2466
    Additional information: MIT STS Marker Data Files
Genes
D14Mit1001 DNA segment, Chr 14, Massachusetts Institute of Technology 1001
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D14Mit1001 a 141bp SPRET/EiJ
b 147bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J
c 149bp C3H/HeJ, DBA/2J
d 151bp A/J, AKR/J, NON/ShiLt
e 153bp CAST/EiJ
f 157bp LP/J
g 161bp NOD/MrkTac
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D14Mit1001 c 145bp CBA/CaOlaHsd
s 144bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory