D12Mit182 Primer Detail MGI Mouse MGI:704597

D12Mit182 Primer Detail

Name

D12Mit182
Primer 1 Sequence

GTACATACAATACATCACACAAACGG
Primer 2 Sequence

GGCAAGAAAACAGACCAATAGG
ID

MGI:704597
Product Size

130
Other IDs

D12Mit182 (BROAD)
Note

MIT assay: MT3431
Additional information: MIT STS Marker Data Files

DNA segment, Chr 12, Massachusetts Institute of Technology 182

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D12Mit182	a	146bp	129X1/Sv
Not Specified	D12Mit182	f	132, 146bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit182	a	118bp	CAST/EiJ
	b	120bp	SPRET/EiJ
	c	132bp	AKR/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J
	d	136bp	LP/J
	e	140bp	NON/ShiLt
	f	146bp	A/J, BALB/cJ
	g	148bp	DBA/2J, NOD/MrkTac

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D12Mit182	c	not given	C58/J
	f	not given	FVB/NJ
	i	smaller	I/LnJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit182	c	126bp	CBA/CaOlaHsd
	D12Mit182	s	125bp	SWR/OlaHsd

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23