About   Help   FAQ
D12Mit182 Primer Detail
Primers
  • Name
    D12Mit182
  • Primer 1 Sequence
    GTACATACAATACATCACACAAACGG
  • Primer 2 Sequence
    GGCAAGAAAACAGACCAATAGG
  • ID
    MGI:704597
  • Product Size
    130
  • Other IDs
    D12Mit182 (BROAD)
  • Note
    MIT assay: MT3431
    Additional information: MIT STS Marker Data Files
Genes
D12Mit182 DNA segment, Chr 12, Massachusetts Institute of Technology 182
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D12Mit182 a 146bp 129X1/Sv
f 132, 146bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit182 a 118bp CAST/EiJ
b 120bp SPRET/EiJ
c 132bp AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J
d 136bp LP/J
e 140bp NON/ShiLt
f 146bp A/J, BALB/cJ
g 148bp DBA/2J, NOD/MrkTac
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D12Mit182 c not given C58/J
f not given FVB/NJ
i smaller I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D12Mit182 c 126bp CBA/CaOlaHsd
s 125bp SWR/OlaHsd
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory