About   Help   FAQ
D11Mit263 Primer Detail
Primers
  • Name
    D11Mit263
  • Primer 1 Sequence
    GAAACCATTTTAAAATATACAGTTCGG
  • Primer 2 Sequence
    CCAGGGTTAGGTAGGTATGGC
  • ID
    MGI:704581
  • Product Size
    145
  • Note
    MIT assay: MT3587
Genes
D11Mit263 DNA segment, Chr 11, Massachusetts Institute of Technology 263
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit263 a 130bp CAST/EiJ
b 144bp B6.Cg-Lepob/+, C57BL/6J, LP/J
c 148bp AKR/J, BALB/cJ, NOD/MrkTac, NON/ShiLt
d 150bp DBA/2J, SPRET/EiJ
e 156bp A/J, C3H/HeJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D11Mit263 a 160bp 129P3/J, A/JOlaHsd, AKR/OlaHsd, C3H/HeJ, JF1
b 144bp C57BL/6JOlaHsd
c 148bp BALB/cJ, SJL/J
d 152bp DBA/2J, PWB
r 150bp C57BL/10
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory