About   Help   FAQ
D11Mit260 Primer Detail
Primers
  • Name
    D11Mit260
  • Primer 1 Sequence
    CACTTTGCCTTTATACTATATGGTGG
  • Primer 2 Sequence
    CATTTGTTTAGTTCTCAGCACCA
  • ID
    MGI:704580
  • Product Size
    95
  • Other IDs
    D11Mit260 (BROAD)
  • Note
    MIT assay: MT3564
    Additional information: MIT STS Marker Data Files
Genes
D11Mit260 DNA segment, Chr 11, Massachusetts Institute of Technology 260
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit260 a 74bp DBA/2J, NON/ShiLt
b 98bp A/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J
c 100bp SPRET/EiJ
d 104bp NOD/MrkTac
e 108bp AKR/J
f 112bp LP/J
g 118bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D11Mit260 c 117bp CBA/CaOlaHsd
s 132bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory