About   Help   FAQ
D8Mit58 Primer Detail
Primers
  • Name
    D8Mit58
  • Primer 1 Sequence
    TGTCTGCATGTAGAAGAGTGCA
  • Primer 2 Sequence
    CTGTGAACTGTGGCATGATAA
  • ID
    MGI:704550
  • Product Size
    166
  • Other IDs
    D8Mit58 (BROAD)
  • Note
    MIT assay: MPC261
    Additional information: MIT STS Marker Data Files
Genes
D8Mit58 DNA segment, Chr 8, Massachusetts Institute of Technology 58
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit58 a 152bp BALB/cJ
b 164bp A/J, AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
c 172bp CAST/EiJ, SPRET/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D8Mit58 l larger LG/J
s smaller SM/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D8Mit58 c 189bp CBA/CaOlaHsd
s 185bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory