About   Help   FAQ
D5Mit200 Primer Detail
Primers
  • Name
    D5Mit200
  • Primer 1 Sequence
    CACAGAGAAGAATCTGCGAGC
  • Primer 2 Sequence
    TTGCAAAGTGTTTTAATCAGTATTTG
  • ID
    MGI:704535
  • Product Size
    108
  • Other IDs
    D5Mit200 (BROAD)
  • Note
    MIT assay: MT2115
    Additional information: MIT STS Marker Data Files
Genes
D5Mit200 DNA segment, Chr 5, Massachusetts Institute of Technology 200
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D5Mit200 a 108bp 129X1/Sv
f 105, 108bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit200 a 93bp CAST/EiJ
b 97bp SPRET/EiJ
c 101bp BALB/cJ
d 105bp C3H/HeJ, DBA/2J
e 106bp LP/J
f 107bp B6.Cg-Lepob/+, C57BL/6J
g 108bp AKR/J, NOD/MrkTac, NON/ShiLt
h 109bp A/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D5Mit200 c 100bp CBA/CaOlaHsd
s 114bp SWR/OlaHsd
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory