D13Mit19 Primer Detail MGI Mouse MGI:704525

D13Mit19 Primer Detail

Name

D13Mit19
Primer 1 Sequence

GGTGAGTTGTGTAATGATGGACA
Primer 2 Sequence

AGCAACAGGGCTACTAAACACA
ID

MGI:704525
Product Size

150
Other IDs

D13Mit19 (BROAD)
Note

MIT assay: B154
Additional information: MIT STS Marker Data Files

D13Mit19

DNA segment, Chr 13, Massachusetts Institute of Technology 19

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D13Mit19	b	smaller	C57BL/6J
	D13Mit19	f	larger	FVB/N

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D13Mit19	m	155bp	MOLF/EiJ
Not Specified	D13Mit19	s	145bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit19	a	132bp	SPRET/EiJ
	b	150bp	AKR/J, C57BL/6J, DBA/2J, NOD/MrkTac
	c	152bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, LP/J, NON/ShiLt
	d	172bp	CAST/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24