D13Mit13 Primer Detail MGI Mouse MGI:704522

D13Mit13 Primer Detail

Name

D13Mit13
Primer 1 Sequence

CTGTGGTAAGTCCAGATTTG
Primer 2 Sequence

GGAAAGAGTAGGAAGATGCC
ID

MGI:704522
Product Size

149
Other IDs

D13Mit13 (BROAD)
Note

MIT assay: D24
Additional information: MIT STS Marker Data Files

D13Mit13

DNA segment, Chr 13, Massachusetts Institute of Technology 13

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D13Mit13	c	138bp	C3HeB/FeJLe
	D13Mit13	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit13	a	138bp	A/J, BALB/cJ, C3H/HeJ, LP/J
	b	140bp	CAST/EiJ
	c	142bp	DBA/2J, NOD/MrkTac, SPRET/EiJ
	d	148bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, NON/ShiLt

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24