About   Help   FAQ
D13Mit10 Primer Detail
Primers
  • Name
    D13Mit10
  • Primer 1 Sequence
    AGTCCTGCCATTTGTCCTCTGACC
  • Primer 2 Sequence
    ATGTCTTAGTCTCACATGCTGGGG
  • ID
    MGI:704521
  • Product Size
    48
  • Note
    MIT assay: L61
Genes
D13Mit10 DNA segment, Chr 13, Massachusetts Institute of Technology 10
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D13Mit10 m 166bp MOLF/EiJ
s 136bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D13Mit10 a 103bp SPRET/EiJ
b 136bp CAST/EiJ
c 147bp AKR/J
d 150bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J
e 156bp A/J, BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac, NON/ShiLt
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D13Mit10 a 160bp 129/SvW, BALB/cW
b 152bp A.CA/W, C3H/W, C57BL/6W, C57BL/10W, CBA/W
c 149bp AKR/W, DBA/2W
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory