D13Mit10 Primer Detail MGI Mouse MGI:704521

D13Mit10 Primer Detail

Name

D13Mit10
Primer 1 Sequence

AGTCCTGCCATTTGTCCTCTGACC
Primer 2 Sequence

ATGTCTTAGTCTCACATGCTGGGG
ID

MGI:704521
Product Size

48
Note

MIT assay: L61

D13Mit10

DNA segment, Chr 13, Massachusetts Institute of Technology 10

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D13Mit10	m	166bp	MOLF/EiJ
Not Specified	D13Mit10	s	136bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit10	a	103bp	SPRET/EiJ
	b	136bp	CAST/EiJ
	c	147bp	AKR/J
	d	150bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J
	e	156bp	A/J, BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac, NON/ShiLt

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D13Mit10	a	160bp	129/SvW, BALB/cW
	b	152bp	A.CA/W, C3H/W, C57BL/6W, C57BL/10W, CBA/W
	c	149bp	AKR/W, DBA/2W

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/21/2024 MGI 6.23